Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10994B5
Clone ID IST10994B5
Vector VICTR76
Project tigm

Sequence tag IST10994B5HMF1
Sequence
GCANAACTCATTGGATTTGGCTCAAAGAGGTTGGAGCTTGGTGACCCCTATTTGTTACTTTTTCCCTCANATATATATGA
ACAATGAATTTGTATTCTAAAGCGTGCCTTGATGAGCAGTGTGTACCTTTTCTTGTGTCTGTTTTCAAGGCTTTCCTCCC
TCATTATGTTTCTGGCTTCAAGTGTGCTTTTAAAATTCATCCCTTCCAAAAAGTCAATCTATACATTAAAAATTACTCCT
CTTTTCTGTANAACGTCCTCATCTTCACCTANNGTGGACACGGTGAGATGGTTTTGTTCCTCCTAAGCNAGCCCCGACAG
GCCCATGACACTGGCTACTGCTGTAACTGTACATTTCTATACATAATTGATGACCTGGGCCCCCACAGACTGCACCAGTA
CACCGNAGTGTACNNNACNNTACANNNTN

Sequence Type genomic DNA
Unitrap ID UNI31932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81167805..81168228 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es