Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11466C3
Clone ID IST11466C3
Vector VICTR76
Project tigm

Sequence tag IST11466C3HMR1
Sequence
GCATTCTCATCAAATGTCNTAAAATCNGACCGTAGTTGATTAGGATCTTTTGCATTGGAGAGACAAACTTTTGCATCAGG
TGTGGTGGCACACTTGAGGCTAAGGCAGAAAGGTTGTGACATCAAGACTAGCTTGCCTGGGTTTCTTAGTTACTATTGAT
GTGACGAAACACCATTTGAAACAATTTGGGGAGGAAAGAGTTTATTTATATTGCTTATACTTCATATTCTTAGTCCATCA
TAGCAGAGCAAGAACTTGGAGGCAGGAGCTGCTAGTCCATGGAGGGTGCTGCTTGCTTCTCATGGCTTGTCCAGCCTCTG
TTTCTTATAGAACCCAGGACTGCCAGCACAGGGATGACCCCCACCCCAAGTGAGCTCGGCCCTTCAATCACTAATTAAGT
AAATGCCTTACATCTGGATCTTACGATGGCATTTTTCTNAGTTGGGTTCCCTCCTCTCANANGACTGTAACCAGTGTTGA
NGTGACAAATTANCCNGCATACTGATAAGTTACTTGGTTACTGTN
Sequence Type genomic DNA
Unitrap ID UNI13400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127507917..127508440 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]


Sequence tag IST11466C3BBF1
Sequence
ATGCCNAGTATANAACACCAGCTTTTTTACAATTATAAAAATGTATTGCCGGGAGTGGTGGCACACGCCTTTAATCCCAG
CACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACNNTGAAACCCT
GTNTANAAAAGCCAAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127507737..127507920 172
NO GENE  

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es