Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12320-NR
Clone ID PST12320-NR
Vector U3NeoSV1
Project escells

Sequence tag PST12320-NR
Sequence
TGAGAAAGCCTTGCGGACAGTGGAGGAAAGTGAGTATAACAGTCAGGCTGGTGAGAGCCCTGTGCCCAGCTCCCCCATCT
TTGGTGCCACCTTTCTTGTCTTTCCCAGCTCTTCTTTTCCTCCTATTCCCTCCCCATTGATGCTTATCATGTCTAATGAA
TCTTTCTTAGTCAGGGTTTCTATTCCTGCACAAACATCATGACCAAGAAGCAGTTGGGGAGGAAAGGGTTTATTCAGCTT
ACACTTCCATACTGCTGTTCATCACCAAAGGAAGTC
Sequence Type genomic DNA
Unitrap ID UNI15142

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131066935..131067209 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037523 (D430028G21Rik) NM_144888 RIKEN cDNA D430028G21 gene Gene [Source:MGI Symbol;Acc:MGI:2444773]

 
Come back to gene ENSMUSG00000037523


For any suggestions or comments, please send an email to unitrap@crg.es