Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11200D5
Clone ID IST11200D5
Vector VICTR76
Project tigm

Sequence tag IST11200D5HMR1
Sequence
GTTGGGAGTAAGGATATGCCACCNTGCCCANCAAGGCTTTGATTGATAGATTC
Sequence Type genomic DNA
Unitrap ID UNI8107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97135563..97135614 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001441 (Npepps) NM_008942 aminopeptidase puromycin sensitive Gene [Source:MGI (curated);Acc:Npepps-001]


Sequence tag IST11200D5BBF1
Sequence
AACACATGAGAGGCAGAGACAGGCACCTCAGAATAAATAAAGAATTTAAATACACAGATTACTGACATGTGTACTCTGTG
ACTACTTATAAACAGGATGAAGTTAAAACTGTACTATGCCGCATTCTGCACTTATCTCTAGGTGGGTAACAGGAGTTACC
TTTGAGCATAGTAAAACAGGAAAATGAATTTCCGTGGTATTCGTTATTATTCTCCCCTTCCCCCCATTTTGAGACAGGGT
CTCTCTATGTAGCTCTAGCTATCCTGGAACTTTTCTAAGTGGACCAGGATAGCAGTGAGTTCAGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97135612..97135922 311
 
EST/CDNA Est Name
  BB844977.1 - BY280330.1 - BY304306.1 - BE372634.1 - BY123288.1 - BY124775.1 - CA316456.1 - CJ182484.1

 
Come back to gene BB844977.1 - BY280330.1 - BY304306.1 - BE372634.1 - BY123288.1 - BY124775.1 - CA316456.1 - CJ182484.1


For any suggestions or comments, please send an email to unitrap@crg.es