Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13675E2
Clone ID IST13675E2
Vector VICTR74
Project tigm

Sequence tag IST13675E2HMF1
Sequence
CTCCACACCAAAGCCTGTCCACTGAGGCATGTAGCCTTCTTCATACTCATCAAAGACCANATCAACCTAGATGCTTCTTT
ATGGGTGGGTAGACACACGGTGACGTGTGGACAGACGGGACTATTACTGAGCAAGGGAAAAAAGAGGAAACTGTTCACAC
GCATGTCC
Sequence Type genomic DNA
Unitrap ID UNI14978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113281534..113281700 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]


Sequence tag IST13675E2BBF1
Sequence
CTCCACACCAAAGCCTGTCCACTGAGGCATGTAGCCTTCTTCATACTCATCAAAGACCAGATCAACCTAGATGCTTCTTT
ATGGGTGGGTAGACACACGGTGACGTGTGGACAGACGGGACTATTACTGAGCAAGGGAAAAAAGAGGAAACTGTTCACAC
GCATGTCAACGTGACAGCACCCCAAAAATCAACGCGGTGAATGAAAGGGATGAGATGCTAAATCTACACTTCAAGATTGC
NTCCGGGTGTGACATTAGGGGGTTGGGGAGAACAGGTGGGTTGCAGTANTACTGCTGTGGAGGTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113281391..113281700 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]

 
Come back to gene ENSMUSG00000031750


For any suggestions or comments, please send an email to unitrap@crg.es