Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13849E6
Clone ID IST13849E6
Vector VICTR74
Project tigm

Sequence tag IST13849E6HMF2
Sequence
GCCTGACACCTANATGGTGTTGGGAGTGAAGCTGTCACCAGGACGTAGAGGACTTACTGAAAAGATGGCTTGGGAGTGAG
GACCTGGGTCCACAATCCCAAGTAACCTTAATCTCCAAAATTGGTCTCGGAAAAAAGCAAAGGTTCCAAGAAAGATAGGC
TTATTAACAAAAGAGAGGCAGGGCCCTGGATGAGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117047012..117047210 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST13849E6BBF1
Sequence
AATGTTCATCATTTGAATAACAATATTTGCCAAGTTTCCCCACTAAAGCATTTCTACTTCTACCTACCCCTGACTCTATT
CTTCAAACATGAATCATTAAGTCAAGCCCACCTTCAAGGAANAAAGATGTTGGAATTAAGCTGCTTCTCCATGAAGTTGC
AAAAGCTACATCAATTATTTGGAATTCTTCCACAAGCGAGACATGCCTTTCTCTCCACTCCCCATTTATATCAGTTTGTA
TCATTTATAGCACAGATGTGGGCCCATTTCCCACATGGAACAATAATCCACATGCTTTCCTTTGTGGCTCCTCTGATCGT
ANCTTGGCCCAGTAGGGACTCTTTCAGGTTCCTCTGACATGTTCCCAGTGGTTTTTAAAAGCATTTTTTTGTTTCTGACA
CAGTAAGATACTCTATGTCATTTTATATTTTTCNACAGCAATCNNAATCATTATTGAATCTCAAAANGAATCNTAAANNC
TTTTATGANTCCCAGGATGTAATCCATTTGANGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 63442230..63442745 490
 
EST/CDNA Est Name
  BI110557.1 - BI106385.1 - BG920824.1 - BI154981.1 - BB284471.1 - CK336474.1 - CJ153250.1 - BB253494.1 - BI083269.1 - BB635815.1 - BB657631.1 - AU080325.1 - AU080326.1 - AU080753.1 - CJ092881.1 - BY243525.1 - BB853238.1 - CJ162108.1 - CN688004.1

 
Come back to gene BI110557.1 - BI106385.1 - BG920824.1 - BI154981.1 - BB284471.1 - CK336474.1 - CJ153250.1 - BB253494.1 - BI083269.1 - BB635815.1 - BB657631.1 - AU080325.1 - AU080326.1 - AU080753.1 - CJ092881.1 - BY243525.1 - BB853238.1 - CJ162108.1 - CN688004.1


For any suggestions or comments, please send an email to unitrap@crg.es