Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10948D8
Clone ID IST10948D8
Vector VICTR76
Project tigm

Sequence tag IST10948D8HMR1
Sequence
TCTTCCTTACTGGTCCCAGCATCTGTCCCTGCTTGTCTCTTATGCTAGGCAGACCAGCCAGCTGCTGTCACCTGAAGTAC
TCAGAGAGACTCCTGTGAACCTGATTATAATGAGGCTGTCTGTGGATTTTTTTTTCTTTTTAANCTTCCAAGCAACCGCA
NANAAAACTACCCCCTGCAGGGGCAAAATCTGAGANAGGTAACTCTGGGTCCATTGCCCTGAATGGGTGGGCANACCCTC
TTGGTGTGTATTCNGN
Sequence Type genomic DNA
Unitrap ID UNI31128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104169051..104169303 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST10948D8HMF1
Sequence
GATGTAGCCAATCANCACGGANCCNNCTAAGCACAGGTGAGCCTGGAAGAGCCCCTGCTCCAGGCTATTGTGGGAGTGAG
ACCAGCAAGGCGTTAAGGGTGAAGTGCCNCANCTGAACCCCACTTANCACATCATTAATGCTCCTANACCATNNNTGNAT
GANAAACNCNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es