Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13061G9
Clone ID IST13061G9
Vector VICTR76
Project tigm

Sequence tag IST13061G9HMR1
Sequence
AACCTGCTTGGGGTTGTTTTTAAAGAAAAGCCATTCTGGGCAGTCTATGTGGCTGTAAAGTGTTTGAATGTTTAGAGTTT
GGGAAGATGGTACAGC
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32418592..32418686 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es