Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12248-NL
Clone ID PST12248-NL
Vector U3NeoSV1
Project escells

Sequence tag PST12248-NL
Sequence
TCTGCAGGTATATCACACACAGTAGCTATAGTCTCTTTCATTGTGGTTAATCTTAGGACGTGATAGGAGACAGAAATCCT
AACTGCTGATCTCTGTAGTTAGGGTTTGGTAAGTTTATTTCTGCAAAATTATATTATTGCATTTAACATAGGAACATTTC
TTTCATGCTTGGTAA
Sequence Type genomic DNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98626352..98626525 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es