Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13640H3
Clone ID IST13640H3
Vector VICTR74
Project tigm

Sequence tag IST13640H3HMF1
Sequence
ATCNCTAACGCANAATTCACAGAAACCAGAGCCATTTGCTTATGGATGCCGCACAGCCAGATGCTCANCAGTGCCTGTTT
AAACAGACGAGTCGTCTCCTTGCCAGCGAGTTGTGCATGATTGTGTCATCTGCCCATCGGCTTGTTTTTCTCGCCCACNN
AAATANTCNANGGNNNTGTGAANATGACCCTGGGTATGATCTGGACCNTCNTCCTCCGCTTCGCCATTCANGACATCNNN
NTGGNAGGNAAAGTTCATGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13640H3BBF1
Sequence
ATNACTAACGCAGAATTCACAGAAACCAGAGCCATTTGCTTATGGATGCCGCACAGCCAGATGCTCAGCAGTGCCTGTTT
AAACAGACGAGTCGTCTCCTTGCCAGCGAGTTGTGCATGATTGTGTCATCTGCCCATCGGCTTGTTTTTCTCGCCCACAG
AAATAGTCGATGGCAATGTGAAGATGACCCTGGGTATGATCTGGACCATCATCCTCCGCTTCGCCATTCAGGACATCTCA
GTGGAAGGTAAAGTTCATGGGGGTGGTCCACGTGTCTAATTTGGGAACTGAGCTTACAAATTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI27501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12401106..12401413 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052374 (Actn2) NM_033268 actinin alpha 2 Gene [Source:MGI (curated);Acc:Actn2-001]

 
Come back to gene ENSMUSG00000052374


For any suggestions or comments, please send an email to unitrap@crg.es