Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10765E3
Clone ID IST10765E3
Vector VICTR76
Project tigm

Sequence tag IST10765E3HMF1
Sequence
TGGAAGATAAATGATAATCAAGTATTTGGACAAAATGGCTGGAAATCATGAAGCCTATTTTCAAAGCCAGAGAGATAACT
GTACAGCTCAAGGCTTAGAAGAAAGGCCACTTCCTTATTTTAACAGCCACTTCTTTTCAGGTTAGGGATGAAGGAGAGAG
CAAAGAGTTTAAAAAGTCATTATGCGTCGTTTANAAACGAGAACCCACTGTGTCACCACCACTCCAGGAACCCCTGTACN
TTCTGGCAAGTTCTGTACTCTGTGGCAGGTAGCACATGAGTGTCTAANCGCGGCTTGGANACTGANAGCTCCCCTTTTAN
ACTCTTCCCACAGCCNGGGATAAGGTCAGGGCTAATTNNGCCCCTGCTCCACAGCANACGGGGCAGCGGACAGAGCCCTA
CCTACTTATCATCTGATTTGCTTCAAGCGTTCAAACTCACTAAGATCCAGCCNGTACTCNNAGACGTCTNAGCANAGCCN
CAGGGACAGACTTTGGCCTGNNNCTCTCAAANCTTTGCNACACN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10765E3HMR1
Sequence
TTCNNGAGTTTGTAGGAATGCTAACGTTAAGTTCATTTTCTCCAGTATTTTCTTTATTTAAAAATGTATTTAATAGACAC
AGTTC
Sequence Type genomic DNA
Unitrap ID UNI6229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107756122..107756205 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]


Sequence tag IST10765E3BBF1
Sequence
TGGAAGATAAATGATAATCAAGTATTTGGACAAAATGGCTGGAAATCATGAAGCCTATTTTCAAAGCCAGAGAGATAACT
GTACAGCTCAAGGCTTAGAAGAAAGGCCACTTCCTTATTTTAACAGCCACTTCTTTTCAGGTTAGGGATGAAGGAGAGAG
CAAAGAGTTTAAAAAGTCATTATGCGTCGTTTAGAAACGAGAACCCACTGTGTCACCACCACTCCAGGAACCCCTGTACG
TTCTGGCAAGTTCTGTACTCTGTGGCAGGTAGCACATGAGTGTCTAAGCGCGGCTTGGAGACTGAGAGCTCCCCTTTTAG
ACTCTTCCCACAGCCAGGGATAAGGTCAGGGCTAATTCNGCCCCTGCTCCACAGCAAACGGGGCAGCGGACAGAGCCCTA
CCTACTTATCATCTGATTTGCTTCAAGCGTTCAAACTCACTAAGANCCAGCCNGTACTCNAAGACGTCTCAGCAAAGCCN
CAGGGACAGACTTTTGGCCTGCAGGCTCTNAANNCTTTGCAACACAAANGCTANTTTTACAAACTGCACN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107755580..107756126 523
NO GENE  

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es