Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10455E8
Clone ID IST10455E8
Vector VICTR76
Project tigm

Sequence tag IST10455E8HMR1
Sequence
AGCTCTGTCTCCCAAGTGCTAAGATTAAAGTCATGTACCACCATGCCTGACTTCATGTTCGTTCTGTAAGACGTGAGTAG
AAGTTGTCTAACTGTGGCGTTACAAAGGACGTCAGTGTCTCACTTCTGCTCCTATCCCAACAGGCCTGAGGAGCGATGAG
ACAGGCATGATGGAAGTCGAGTCCTCCTACTCGGACTTCATCTCCTGCGACCGGACNGGCCGTCNGAATGCAGTCCCTGA
CATCCAGGGTGACNCNGANGCCNTGANTGN
Sequence Type genomic DNA
Unitrap ID UNI20976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163546721..163546989 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035268 (Pkig) NM_001039390 protein kinase inhibitor, gamma Gene [Source:MGI (curated);Acc:Pkig-001]

 
Come back to gene ENSMUSG00000035268


For any suggestions or comments, please send an email to unitrap@crg.es