Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13926H5
Clone ID IST13926H5
Vector VICTR74
Project tigm

Sequence tag IST13926H5BBF1
Sequence
NCAGGGAAGGTGCGCANATATCTTGTATTTGGACCTCCTCCTGGCCGAANAAAAAGGCCCAAAACAGGACCTTTCTCAGA
CACTGTGTTGCTTTGGCAGTTCCCAGGTGGTACANACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCG
GGACCAANATGGCGACCGCTGCTGCTGTGGCTTANGTCNCCTCCCCANCCGGGCGGGCACNTGTCCTCCGGTCCGGAAGG
TGGCCGGCTGTCCCCGCCCN
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI32191 UNI32730 UNI34917 UNI34918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4550991..4551248 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 121381404..121381661 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71797483..71797740 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 82083735..82083992 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 31798437..31798694 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052920 (Prkg1) NM_011160 protein kinase, cGMP-dependent, type I Gene [Source:MGI Symbol;Acc:MGI:108174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 9134775..9135032 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 39088033..39088290 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12886505..12886762 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055963 (OTTMUSG00000004461) NP_776107 predicted gene, OTTMUSG00000004461 Gene [Source:MGI Symbol;Acc:MGI:3650048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987388..3987645 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 32044564..32044821 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 126648475..126648732 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030968 (1700007B13Rik) RIKEN cDNA 1700007B13 gene Gene [Source:MGI Symbol;Acc:MGI:1919080]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 29977419..29977676 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 81829834..81830091 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043289 (4930486G11Rik) NM_175213 RIKEN cDNA 4930486G11 gene Gene [Source:MGI Symbol;Acc:MGI:1922283]

 
Come back to gene ENSMUSG00000043289


For any suggestions or comments, please send an email to unitrap@crg.es