Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14472H4
Clone ID IST14472H4
Vector VICTR74
Project tigm

Sequence tag IST14472H4HMF1
Sequence
GTTGTGCTGGCTAACTTTTCATCAGCTTAACAAAAAAAGCTAGAGCCATTTAAAAGAAGGGACGCTCAACTGAGAAACTG
CCTCCTTAAGAGTCATCTGCAGAAAACTATAAGGCATTTTCTCAATCAGTGATTGATGCAGAGGTCCCAGGCCAAGTGGG
TGGTGCTACCCTCAGGCAGTATGATCCTCTGGTGCATAAGAAAGCAGGCTGAGCAAGCCAGGAAGAGCAAGCCAGTGAGC
ACCCNCCACCCCCACCCCCNAAGGTTTCTANNACNGTTCCTGCCTCCAGGCTCCNGTCNTGAATTCCTGCNNTGACTTNN
CTCANNGATGACTGTAAGCAAAATANACCCTTTCCTTANTTGTTTGNGGTCATGGTGTNNNANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14472H4HMR1
Sequence
CAACAACAACAACAACAACAGAAACAAACAACAGAGATTATAGAGTCTACATGCACAGTCC
Sequence Type genomic DNA
Unitrap ID UNI34919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126127436..126127495 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es