Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14768C12
Clone ID IST14768C12
Vector VICTR76
Project tigm

Sequence tag IST14768C12HMR1
Sequence
ACGTGATTCCACTTCTTCTGGATCTATTGATTTGAGTTGGTGATACTGTTGGGTCAGAACCAGGGCCTGCACTACCGAAA
TTCTGTCTTTTACAAACTGGACCAAGCGGTTGAGAATACAGGGTCCGAAGAGTAGGATTAATAAAAGTATTATCAAGGGG
CCCATAATGGTGGATATCAAGGTCGTGAACCATGGGGACCTGTTAAACAGTCCCTCAAACCACCCTTGTCCTGATTG
Sequence Type genomic DNA
Unitrap ID UNI30769 UNI30770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 184195259..184195494 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41164462..41164697 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6650162..6650397 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99756967..99757202 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93698439..93698674 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 82870850..82871085 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 61001824..61002059 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003228 (Grk5) NM_018869 G protein-coupled receptor kinase 5 Gene [Source:MGI Symbol;Acc:MGI:109161]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57067560..57067795 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 101536499..101536734 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44397697..44397932 232
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62294851..62295086 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041729 (Coro2b) NM_175484 coronin, actin binding protein, 2B Gene [Source:MGI (curated);Acc:Coro2b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 52416008..52416243 232
NO GENE  


Sequence tag IST14768C12HMF2
Sequence
NTGGTTCGCCTGCATGTCTGTTGTCTGCATGTCTACTTCCTTGTTCTGTCACTCGGTTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3115685..3115742 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74917318..74917375 54
NO GENE  

 
Come back to gene ENSMUSG00000041729


For any suggestions or comments, please send an email to unitrap@crg.es