Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14997A5
Clone ID IST14997A5
Vector VICTR78
Project tigm

Sequence tag IST14997A5BBF1
Sequence
CTAATCAGACTTTGCCTATAGTTTTTCTTTTTGTTTTTTCTTTCTTTCTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14155543..14155622 80
NO GENE  


Sequence tag IST14997A5HMR1
Sequence
TTNNAGTCTGGAGACTTATTTCANCCNAGTGAAGAGGAGAGTTCTCACCTAGAGATGTGCACTGTCCACGATTTGGCTCT
GTCTTTCAAGAATGCCTATGTCCATTCTCATTTGAAAAGTTGTAGTGGCTGGGGAGGTGGCTCAGTAGGTAAAGTACTTG
TTGCATAAGCACAAGGACCTGAATTTANTCCCTANCACCTACAGAAAAGCTGGTTGTGGTC
Sequence Type genomic DNA
Unitrap ID UNI4745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14155327..14155542 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060657 (4921513D23Rik) NM_001081154 RIKEN cDNA 4921513D23 gene Gene [Source:MGI Symbol;Acc:MGI:2444505]


Sequence tag IST14997A5HMF1
Sequence
NTAATCAGACTTTGCCTATAGTTTTTCTTTTTGTTTTTTCTTTCTTTCTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14155544..14155621 78
NO GENE  

 
Come back to gene ENSMUSG00000060657


For any suggestions or comments, please send an email to unitrap@crg.es