Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15108C4
Clone ID IST15108C4
Vector VICTR80
Project tigm

Sequence tag IST15108C4HMF1
Sequence
TTAGAAGACCGAGGAAATCGTTTGCTTTGTTTCTCAATTTGAAAAGGTGCTGAAAGGGCCGTGACCTTCCCAGAAAAAGG
ACTGTCCCTTGGGTGTTGTTTCTTTTTTAAGTTTTCTGAGACACCTGTTAGAAGCATTGTGTCACCTTCCAGTAGAGGAA
CATGGGTAATAAACAGCTATATCATTACCTGTGTTTCTAATGTTGCAGAATTAACTGGGGAGAAAGGTGGCTTTTCTAGA
CCACTTCCTTCATAAGAGGAAATTCACCTCCACGTGAGCCTTGGGGAATGCTTATAAAGATTATCTCAAAAGGGTAAGAA
TAGACCTGCAGTCAGTAAATTACAGAGGCAGAGTGATTAAGTATGGGGCGGTGTTTTGCCTCCAGTGAATCNCCTGTAAT
TCACCTCCCGCCCAGTGGCATTGGGTCAGGANACTTGNANCTGNNAATTGTGTAANGCTAACACTGAANGGNGATCCATA
TGANNGNTGGAN
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57295174..57295664 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST15108C4BBF1
Sequence
TTAGAAGACCGAGGAAATCGTTTGCTTTGTTTCTCAATTTGAAAAGGTGCTGAAAGGGCCGTGACCTTCCCAGAAAAAGG
ACTGTCCCTTGGGTGTTGTTTCTTTTTTAAGTTTTCTGAGACACCTGTTAGAAGCATTGTGTCACCTTCCAGTAGAGGAA
CATGGGTAATAAACAGCTATATCATTACCTGTGTTTCTAATGTTGCAGAATTAACTGGGGAGAAAGGTGGCTTTTCTAGA
CCACTTCCTTCATAAGAGGAAATTCACCTCCACGTGAGCCTTGGGGAATGCTTATAAAGATTATCTCAAAAGGGTAAGAA
TAGACCTGCAGTCAGTAAATTACAGAGGCAGAGTGATTAAGTATGGGGCGGTGTTTTGCCTCCNGTGAATCACCTGTAAT
TCACCTCCCGCCCAGTGGCATTGGGTCAGGANACNNGNANCTGGCAANTGTGTAANGCTANCACTGANTGGGGANCN
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57295191..57295664 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es