Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14888D3
Clone ID IST14888D3
Vector VICTR76
Project tigm

Sequence tag IST14888D3HMF1
Sequence
CCCTGTCTCGAAAAACAAAACAAAACAAAACAAAAAAAAGCAAAACAAAAGGTAGCTCAAAAGANAAAGAAAACTCTTTC
ACTCTGAAAATAAAATAGGTCTACCTGGGCATAATGGTGCATGCCTTTAATCCGAGCACTGGGGGGGGGGNGGGGGGGTG
TN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8867497..8867657 157
 
EST/CDNA Est Name
  BQ554608.1


Sequence tag IST14888D3BBF2
Sequence
CCCTGTCTCGAAAAACAAAACAAAACAAAACAAAAA
Sequence Type genomic DNA
Unitrap ID UNI6521 UNI9831 UNI11418 UNI17861 UNI34922 UNI34923 UNI34924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4555719..4555754 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024892 (Pcx) NM_008797 pyruvate carboxylase Gene [Source:MGI Symbol;Acc:MGI:97520]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 31984470..31984505 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024400 (Wdr33) NM_028866 WD repeat domain 33 Gene [Source:MGI Symbol;Acc:MGI:1921570]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 22308194..22308229 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4776654..4776689 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16396665..16396700 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8867497..8867532 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 29504466..29504501 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036613 (Tssc1) NM_201357 tumor suppressing subtransferable candidate 1 Gene [Source:MGI Symbol;Acc:MGI:1289332]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4405788..4405823 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034354 (Mtmr3) NP_083136 myotubularin related protein 3 Gene [Source:MGI (curated);Acc:Mtmr3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21105594..21105629 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003309 (Ap1m2) NM_009678 adaptor protein complex AP-1, mu 2 subunit Gene [Source:MGI Symbol;Acc:MGI:1336974]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12615925..12615960 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 22203637..22203672 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11669663..11669698 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30474795..30474830 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3625094..3625129 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 13427471..13427506 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55459823..55459858 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33357089..33357124 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7389248..7389283 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031153 (Gripap1) NM_207670 GRIP1 associated protein 1 Gene [Source:MGI (curated);Acc:Gripap1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 23035964..23035999 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026775 (Yme1l1) NM_013771 YME1-like 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Yme1l1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 39653668..39653703 36
NO GENE  


Sequence tag IST14888D3HMR1
Sequence
GGGTTTCTCTGTGTACCCTGGCTGTCCTANNGCTCACTCTGTANACNNGGCTAGCCTCNAACACAGAAATCCGCCTGCCT
CTGCCTCCCTAGTGCTAGGATTAAAGGCATGCCACCACGCCCGGCTTCANTTACCTTTTTAATACTGTCTAGTTTGTAAA
ATACCATCANACTACAAATTGAAGTTGAAAATTCTCCCTCACAGTGGTTTTGTGTGANGATCANTGCCTCTGTNTTNGTG
GATCNANTTNNNTNNNATNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026775


For any suggestions or comments, please send an email to unitrap@crg.es