Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10262H10
Clone ID IST10262H10
Vector VICTR76
Project tigm

Sequence tag IST10262H10HMF1
Sequence
TGTTTATGCTGGGCGCGTTTTCTTTCCTGTTTGGGAATGGGTACTGGAACGGGAAGCCGGAGAGGGGGTGGGGGCAAGCT
CCAGTAAGTGAATCTTTTCTCTACATAACCAGTGACTCAGTTGTGGATACTCATAAGATGCGCATTCTTGTCTCTTTGGT
GACACTTTGAGAATTCTCAGTAGTGTAGTGCAGCCACAAACAAGAGTTTCAAATGTAGACTCCGTTGCCCCAGTCCGCTC
TTTATCTTGTTTCCTANTAACTGATGAAAACAGCAGCNTGGCTTCCTGCTGTANACGGAGTGGGGTTAAATTAAGTGGCG
GATGGCCTCANCAAAACCTACAATTTTGCTCTTGTTTGTGTAAAGCTNTTTTTGATTCNTGGTCTGTAAGATTTTGTTTT
TTTTGTTTTTTTTNGTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI30340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 103593719..103594139 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008730 (Hipk1) NM_010432 homeodomain interacting protein kinase 1 Gene [Source:MGI (curated);Acc:Hipk1-001]


Sequence tag IST10262H10BBF1
Sequence
TGTTTATGCTGGGCGCGTTTTCTTTCCTGTTTGGGAATGGGTACTGGAACGGGAAGCCGGAGAGGGGGTGGGGGCAAGCT
CCAGTAAGTGAATCTTTTCTCTACATAACCAGTGACTCAGTTGTGGATACTCATAAGATGCGCATTCTTGTCTCTTTGGT
GACACTTTGAGAATTCTCAGTAGTGTAGTGCAGCCACAAACAAGAGTTTCAAATGTANACTCCGTTGCCCCANTCCGCTC
TTTATCTTGTTTCCTANTAACTGATGAAAACAGCAGCATGGCTTCCTGCTGTANACGGAGTGGGGTTAAATTAANTGGCG
GATGGCCTCAGCAAAACCTACAATTTTGCTCTTGTTTGTGTAAAGCTATTTTTGATTCATGGTCTGTAAGATTTTGTTTT
TTTTGTTTTTTTTTGTTTN
Sequence Type genomic DNA
Unitrap ID UNI30340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 103593722..103594139 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008730 (Hipk1) NM_010432 homeodomain interacting protein kinase 1 Gene [Source:MGI (curated);Acc:Hipk1-001]

 
Come back to gene ENSMUSG00000008730


For any suggestions or comments, please send an email to unitrap@crg.es