Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14677C12
Clone ID IST14677C12
Vector VICTR74
Project tigm

Sequence tag IST14677C12HMF2
Sequence
TCACCTGTTCANACTAATTTCCTAAGTTCGGCGGGTCTCGGACCNAGATGGCNACCGCTGCTGCTGTGGCTTANGCCNCC
TCCCCAGCCGGGCGGGCACCTGTCCTCCGGTCCGGANGGTGGCTGGCTGTCCCCGGCCCACAAAGGGTGCNNCN
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI29704 UNI30806 UNI31065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 133645..133794 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32011763..32011912 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27621381..27621530 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692574..11692723 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 54867773..54867922 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28188684..28188833 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022262 (Dnahc5) NM_133365 dynein, axonemal, heavy chain 5 Gene [Source:MGI Symbol;Acc:MGI:107718]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14306236..14306385 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363738..22363887 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40233131..40233280 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51378881..51379030 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35522234..35522383 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 31392620..31392769 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24947665..24947814 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 89983674..89983823 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19038913..19039062 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 46791795..46791944 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 69382546..69382695 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5654145..5654294 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 62143041..62143190 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17245615..17245764 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 31757829..31757978 138
NO GENE  


Sequence tag IST14677C12HMR1
Sequence
TGAGAGGGTGCGCCNNANAACCTGANAGCTTCTGGAACAGGCAGAAGCACAGAGGCGCTGAGGCAGCACCCTGTGTGGGC
CGGGGACAGCCGGCCACCTTCCGGACCGGAGGACAGGTGCCCGCCCGGCTGGGGAGGCGGCCTAAGCCACAGCAGCAGCG
GTCGCCATCTTGGTCCNNGANCTNCN
Sequence Type genomic DNA
Unitrap ID UNI32130

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32011910..32012085 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052595 (A1cf) NM_001081074 APOBEC1 complementation factor Gene [Source:MGI Symbol;Acc:MGI:1917115]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 62452679..62452854 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11859982..11860157 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 17196401..17196576 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 90733368..90733543 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 34752460..34752635 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 74476260..74476435 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 80235875..80236050 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 113973006..113973181 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45319805..45319980 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11919374..11919549 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 89616585..89616760 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88975398..88975573 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 80458966..80459141 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 40050396..40050571 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 44709121..44709296 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 171832607..171832782 168
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 31132009..31132184 168
NO GENE  

 
Come back to gene ENSMUSG00000052595


For any suggestions or comments, please send an email to unitrap@crg.es