Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14834A11
Clone ID IST14834A11
Vector VICTR76
Project tigm

Sequence tag IST14834A11BBF1
Sequence
TTCTGACTATTAATCCCATCANCTGANAANCTGGCTAANTTTGCNNATTTTACACCNNCCTGTTGNANCCANTTNCNTGA
NCTGGTTNTTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14834A11HMR1
Sequence
AGAATATAGAAAGAGCTCAGAAATTACAAACAAAATAACCTAAGCTATAAATACTCAAATTGATTAGACAGTTCTCAAAA
TAATACACATGGCCTATAGTTGTATTTAAAAATAACATACTGAGCCATCAGGAAAATGCAGATGAAAACTATACTGTAAT
TTCCTTCTCACACCAGTCAGAATAGTTGTCATCAAGAAAATAAAGAGTGCCGGTGAGTGAGGATAGGAATAGCTCTTAAA
TACCATCGGTTGGGATATAAGTCAGCTCTGCCACCGTGGAGTGTATGCACATTGGTGTATTANGGTTCTCTAGGAACAGG
ACAGAGACTGACGTGTGTGTGTGTGTTCNNCTGGTCNNNNNTATATGACAGANTCTNNAAGTACTANGCN
Sequence Type genomic DNA
Unitrap ID UNI543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48545365..48545753 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]


Sequence tag IST14834A11HMF2
Sequence
NCANATANGGTCAAACTCNATGATCTTTCTGGGGCANCNNNTGAANGANCCNANAAAAATCANGCTGNNNNANANTNNNT
AAAANNNGNGATATCCTANCCNGAANCTCACCCTCCCAAGCCACCTTTATNANTANCTTTGTTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023994


For any suggestions or comments, please send an email to unitrap@crg.es