Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14944A7
Clone ID IST14944A7
Vector VICTR76
Project tigm

Sequence tag IST14944A7BBF1
Sequence
AGAAGAAAACACAAATGAAACGCACACCTGGCGCACGAGCATAATACGAGATTATGGGAAACTTTAAGATGATTAGGAGA
AATCTAGCAATTCTCCAGCCCTTCCCAAGTGCCATAAAACCAAAGGAAAGGGCAGTCCGAGGGAGGGCGCACAGGCTTGG
GTTTGGTGCTGTTTGGGCCTGGGTCTCAGGAAGGCAGCTCCAGGAGCCGTGAGGACAGATTACTTCTCTCTCACCACAAA
AGGCTGGCTGGGACATAAATACACACTTGATTCTTTGCTCTGAGGTGAAATAAGATAATTTATGCAAAACGCCAGCAAGG
GGCGGGCCCTCAGGAAGCCCCTTGAGCACCCACTGCACACGCACTTGGGCCTGCTTAAAGTTTACTCCACCAANCGCTCG
CTCTCANAGCTCTNNNAGNNNCCTTTGCTGGGGGGGGGGNGCNANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81997273..81997714 424
NO GENE  


Sequence tag IST14944A7HMF2
Sequence
AGGGGTGGAGGAGGGTCAGGAGTCACAGGGTGGCTGGGCTTAGGAAAGAGTTCTGCTGCCTGCTACCCCTCTACACCCTC
TGGAGCTTCTCCATTGGAAGGCCCTGGGTAACTGAGGAGGAACTCTTTCCTCTGAATCACAGTCCTTCTGGCACCAGGCT
GGTGGGGGCAGCAGGGAAGACTTGGGTCTGTGACTGCTTGGTGATCAACCATCACATCCATCCGACACACCCTACATCCC
AGGCCAGCCAGAATACCAGCGCCTCATCCCATTCAGGCTCTGGGGCCCCTTCTTGCCTTCCATANACTCANCTTGTAACT
CTGCTGCCCTCACACCCCTGGGTTGGTGTANCATCCTCCTCCCTGTACAGGCCCCAGGCCCCCTCTCTNCTGGAANCANG
NNNNCCTCGTANATCTNANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154607708..154608122 388
NO GENE  


Sequence tag IST14944A7HMR1
Sequence
CTGAGACTCNGGACAGCTCTTAGTTAAAGTGTGGAGAAGGACTTGCCCTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI5488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81997713..81997766 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es