Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13286F5
Clone ID IST13286F5
Vector VICTR74
Project tigm

Sequence tag IST13286F5BBF1
Sequence
CTACCTGCTATGAGCGGTACGGAAAGTCAGGAAGGCCAAAAGAGAATGTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 137046710..137046764 55
NO GENE  


Sequence tag IST13286F5HMF1
Sequence
TTCTGGCTATTATAAATAAGGCTGCTATGAACATANTGGAGCATGTGTCCTTCTTACNAGTTGGGACATCTTCTGGATAT
ATGCCCAGGAGAGGTATTGCTGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI32986 UNI34925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 50913939..50914045 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 104162819..104162925 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29962192..29962298 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 39236606..39236712 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036095 (Dgkb) NM_178681 diacylglycerol kinase, beta Gene [Source:MGI Symbol;Acc:MGI:2442474]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6849428..6849534 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 53131814..53131920 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 15164893..15164999 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 68907473..68907579 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 22267781..22267887 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 12511017..12511123 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21995809..21995915 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 53524739..53524845 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 60117629..60117735 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55866727..55866833 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 41408050..41408156 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 36511122..36511228 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 18199158..18199264 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28676842..28676948 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88869921..88870027 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 433401..433507 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 93883..93989 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35479692..35479798 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050197 (Rhox13) Reproductive homeobox 13 Gene [Source:MGI Symbol;Acc:MGI:1920864]

 
Come back to gene ENSMUSG00000050197


For any suggestions or comments, please send an email to unitrap@crg.es