Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12053E6
Clone ID IST12053E6
Vector VICTR76
Project tigm

Sequence tag IST12053E6HMF1
Sequence
ACTCCCTTATCAGCCAGCTTAGGAGGAATGTTCAAATTTGTACTGCTCACATTTCAGGCCTGAATCTGGCAGAAGTTCCT
GCCTTCCAGGTCCTGATGGGCAGGGTCTAGGAACTTTGCTGGCTCCGACATTTGCTAACAACGGGCGAAGTANCAGCTCC
TCTCCCACTTCACAAGTGAGGGGCGGGAGTGCCAGTTAGTTAGGAAAGGTCCCCAGGCTCGAGGATGCGAGGAGGTGGCG
CGGCCTTAAGCTCGACCAGTGAGGGAGGGAACCGCGCTTCCTCTCAGCCAACTGCTGGCTCATTTCCTGAGCAGGAGGAG
GAGGGAGCGGAAAAGCCGCCAGTGGGCCAGGTCGGGGGCTTTCCGGCGGCTCCCACCTCCCACCCTCATTTTTNNCAGGT
TACGCTCGGCCCCTCCCAGCCCAGANGAGCGCTCACTTCTACCCCTNAGACCGGAAACCTCANGCGANAGTAAAAGGNCC
CCACCCTTCGCAGANAANTGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89884086..89884589 484
 
EST/CDNA Est Name
  CR759714.1 - CR759055.1 - BG064573.2


Sequence tag IST12053E6BBF1
Sequence
TAGGTTTCCCCTGAAGTTTTTGCTAATGTTGCATTACTCGATCATGAATGGCCCCTTGCTATGTCTTGGTCTTCTGACCT
CTTTCCTAGTTTACTAATCTCCGTGCCTGGCAGATTTCCCTGACAAGGAGCCATAGTGGCTTTCTCTTTTATAGAGGCTT
GCTGCCTCCTTCATGTGACCCCGCAATCTTCAGCTAGGGCAGTTGTGGAGACAGGGTTTGATTGTTGTGATTGCAGTGCT
ATCTGCATCTAGTGGGGAGAGGCCANAGATCCTGTTAAATGTTCTGTAATGTGCTGAACAGCCCCCACAGCACAGGCTAG
CCAGCTCAGAGTAACAACATCGAAACAAAGGAACCCTGCACCGACTGGTACGCCCTGCTTTGTCTNATTCAAGCCCTGAT
AACCTGAATTTGATACCTGGAATCCACGTGGTGGAAGGAGGGAACCTGCACCCTCAAGCNNTCCTCTGGTTTCCGTGCAC
ACGCNGAAGAGATGGTGGGCGTTGGGCGTGGGGTGGTGGCATTATATATATATATATTTTTTTNNAA
Sequence Type genomic DNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95074705..95075247 533
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es