Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12013-NR
Clone ID PST12013-NR
Vector U3NeoSV1
Project escells

Sequence tag PST12013-NR
Sequence
GGTTGATGCTCTTTTTCGCTGCGGAGGTGGAAGACCCCAGCCCAACTCTCTGCTGTATTTTCAGACATAACATTTATAAA
CCCTGCCATGGCATAAGTCGAGGCGATGCAGGGGAGAGGGGAATCTGGCTCAAGCAGCAAACGCTTGAAATTAGGGTTTG
ATTAGCTTTCTTTCCGGTATCTTTCTTAGGCTGCCAGCAGCGGAGTCTATGTCAGATATTTCGTTGGCGTGGTAGAAAGG
TGTGATCTTCCTGTAATTTGTCGCGAAATTAAACTCAGATTATAGC
Sequence Type genomic DNA
Unitrap ID UNI8604

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56029047..56029333 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071533 (Pcnp) NM_001024622 PEST proteolytic signal containing nuclear protein Gene [Source:MGI (curated);Acc:Pcnp-008]

 
Come back to gene ENSMUSG00000071533


For any suggestions or comments, please send an email to unitrap@crg.es