Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12003-NR
Clone ID PST12003-NR
Vector U3NeoSV1
Project escells

Sequence tag PST12003-NR
Sequence
TAAGTTTTTAATCTCACACGCCAGGATTATATTGTTAGAACACAGAATATGACACTTACTCACTGGGCTCTGAGGAAAAT
TGGTCTGAACAGAATACCTGTCTGAGTCTCGCATGC
Sequence Type genomic DNA
Unitrap ID UNI14710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155195706..155195820 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029068 (Ccnl2) NM_207678 cyclin L2 Gene [Source:MGI (curated);Acc:Ccnl2-001]

 
Come back to gene ENSMUSG00000029068


For any suggestions or comments, please send an email to unitrap@crg.es