Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0493
Clone ID XR0493
Vector pGT0lxf
Project sanger

Sequence tag XR0493
Sequence
CTGCTGGTCTCTCTCCCGGTCTCGCCTCTCTCCTCACACTCATTGAACGCGGAGGCAGCTGCCGGGCATTCGTGTGGTCT
CGTCGTCAGCGCAGCTGGGCCTACACACAAG
Sequence Type mRNA
Unitrap ID UNI2623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 14467114..14467186 69
 
EST/CDNA Est Name
  CB208837.2 - AW260714.1 - CJ077483.1 - CJ077526.1 - CJ071942.1 - CJ077482.1 - CJ082771.1 - CJ075038.1 - BY735709.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5783561..5783633 69
 
EST/CDNA Est Name
  CB208837.2 - BE306869.1 - CJ077483.1 - CJ077526.1 - CJ071942.1 - AW260714.1 - CJ077482.1 - CJ082771.1 - CJ075038.1 - CX232971.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40609359..40609431 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015656 (Hspa8) NM_031165 heat shock protein 8 Gene [Source:MGI (curated);Acc:Hspa8-009]

 
Come back to gene ENSMUSG00000015656


For any suggestions or comments, please send an email to unitrap@crg.es