Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10928H3
Clone ID IST10928H3
Vector VICTR76
Project tigm

Sequence tag IST10928H3BBF1
Sequence
TAAGGATTTATTTTATGTATATGAGTACACTGTAGCTGTCTTTANCGACACCAGAAGAGGGCATCCGATCCCATTACAGA
TAGTTGTCAGCCNCCATGTGGTTTCTGGGAACTCAGGACCCCTGGAAGAACAGTCAGTGCTCTTAACCACTGAGCTATCT
CTTCAGCCCATGGTTTACATTCTTTGAATATCATCTCCTTTGTCTTCTGACCTGCCTTTGTCTCTACTCCATTTGTTAAT
TCCTTGTCATTATTGTGTACCTTTGTGGATTTTGGCTCTTGGAATGTGGGCATGCTAATTATTGTGCCTTCCGACCTTCA
ACCCCACCTCCTTCACCANACTACTATTTTCTAGAATTCTTTTCTAGAATTGNTGATTTCAACAAGTGCAGTGTTTGTGT
TATAAAATTTTATCANGGTTTTGTTTTGTTTTTATGCTTCTCTATTNGATTCTGTACTATGAAAACAACAATCTANTGCC
TANAGANNNNGCTTANTGNTAAANNNTACTTGTTGCTCTTGCAAAGNACANNNGTTCANNTNNCC

Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70324923..70325460 496
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST10928H3HMR1
Sequence
TTAAAAAAGNNAGAAAAAAAAGAATTAAAAGAATGTAATCCAGAGCAGAGATGGGAAATGGTAAGGCTTACAGAAAGAGT
CTATCACTTTAATGATGAGTAAGAGGGTAAATGGAGATAGGTGACAGGAGAAAATCTTTTTACTTTTCCTTTCTACCTTT
CTTTTGCCTTTTCAAGTCTGGGTCTCTCTGTGTGACCCTGAGTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70325458..70325663 202
 
EST/CDNA Est Name
  CA883725.1

 
Come back to gene CA883725.1


For any suggestions or comments, please send an email to unitrap@crg.es