Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0430
Clone ID XR0430
Vector pGT0lxf
Project sanger

Sequence tag XR0430
Sequence
CCGTACTCCTTTTGGCATTTCCTCTGGCCTTCCCTCCCGTTCCGTCCACCTCTCCCACATCCCTCCCTTCAGTACGCTCC
CTCTATATGCAAACTGCAGCCCATGATCACCAGTGAGACCGGCAAGGCGCTGATTCAGACCTGCCTCAACTCGCCAGACT
CTCCGCCCCGCTCAGACCCCACCACAGACCAGAGAATGAGTGCCACTGGCTTTGAAGAGCCAGATCTCACCTACCAGGTG
TCGGAATCTGACAGCAGTGGGGAAACCAAG
Sequence Type mRNA
Unitrap ID UNI2624

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46690509..46690690 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015605 (Srf) NM_020493 serum response factor Gene [Source:MGI Symbol;Acc:MGI:106658]

 
Come back to gene ENSMUSG00000015605


For any suggestions or comments, please send an email to unitrap@crg.es