Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12051G10
Clone ID IST12051G10
Vector VICTR76
Project tigm

Sequence tag IST12051G10HMF2
Sequence
CTGGGTCTGAAGGAAACTCGTAAACTGAAGGTGCTGGGGCAGCTGCTAAATATGGAGAGTTGCAGGTGTCCGAGGAAGGA
AACTAGTTAAAGGAAAACGTGGGCTTTCGTGGAGTGTACCTCATAGACAGTGGTTTAACAAGGATTTGAAGTCGGACTAT
CTTACCATTCTTCTTAAGAAGGTTGGTCGTTCCTGACCCTGGCAGATGTCGAGATTTGGAACCCAAGGANCACGAAAGCA
GCCTTATAAAAAGAGTTAATCGCAATCATGCCNACTGTTTTAAGTCTTTACCCATGGCAGANAATGATGCTAAAGGCCTT
ATAGTTGTTATCCANNTCATATGTTTGTTANCTANNTCATGACATACANCAGCCCTGTNATACANGCGTCACTTTGCATN
AGTGANGATATN
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 54999123..54999533 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]


Sequence tag IST12051G10BBF1
Sequence
CTGGTGTACACCACTATGCTCTATTTGTAACAGGTTTTCAGGTCTATTTAGGTGTGGATCTTATCTGTCTACTGAGGGTA
GCAGCAGCTTCTTTGTGGAGGGAAAGATGGGCAGAGGGAGTATAGCCTTGAAAGGAGAAGGAAGTCTAAGAGGAGAGGCT
CAGGGGCCTCCTCCTTCCACAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI34958

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180735782..180735922 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016356 (Col20a1) collagen, type XX, alpha 1 Gene [Source:MGI (curated);Acc:Col20a1-003]

 
Come back to gene ENSMUSG00000016356


For any suggestions or comments, please send an email to unitrap@crg.es