Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14382H8
Clone ID IST14382H8
Vector VICTR74
Project tigm

Sequence tag IST14382H8BBF1
Sequence
ACTTTAAAATAAATGTACACAGTAAGTTAATACAGCGGCTGTTTTTCTTTATCCTAGTTAGTGCCCCAAGANTNATCTTC
NACTTAAAATCNCAACAACTANGCATTATAATTATATCATAATCCTCTAATCTGGCTACCTCNCANCCNAAATCCCCGAG
ATACTGGCATTTTTGTATTGNTTTGTCCCTCTGGGCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14382H8HMR1
Sequence
AAGTTACCATTACAGCTCTAGCTTAAAGATGGAATACTTCTAAATAGGAATATGAGCATATGTCTTGTTCTTATTTTAGA
GGAAATGTTCTCTCTATAATATTGGGTGATTTGTCATACACAGCCCCTTTTCATTCTTTGTTTATTCATTTATGTGTGTG
TGTGTGTTGTATGTGTAAATGTATGTGAGGGANTGCTCACCTN
Sequence Type genomic DNA
Unitrap ID UNI9316

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30906345..30906546 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es