Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12472G3
Clone ID IST12472G3
Vector VICTR76
Project tigm

Sequence tag IST12472G3HMF1
Sequence
TTGGGAGCCCGTGGGCCAGGCGTTCTGGGCCTGGGGCATTCTGGGAAGGGCCTGGGCTCCTGGAGGGGACTTTTTTTTTT
TTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI19205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25292625..25292718 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064264 (Zfp428) NM_146183 zinc finger protein 428 Gene [Source:MGI Symbol;Acc:MGI:1916463]


Sequence tag IST12472G3BBF1
Sequence
TTGGGAGCCCGTGGGCCAGGCGTTCTGGGCCTGGGGCATTCTGGGAAGGGCCTGGGCTCCTGGAGGGGACTTTTTTTTTT
TTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI19205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25292625..25292719 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064264 (Zfp428) NM_146183 zinc finger protein 428 Gene [Source:MGI Symbol;Acc:MGI:1916463]

 
Come back to gene ENSMUSG00000064264


For any suggestions or comments, please send an email to unitrap@crg.es