Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14342E8
Clone ID IST14342E8
Vector VICTR74
Project tigm

Sequence tag IST14342E8BBF1
Sequence
ATATGTAAGTTCACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10931 UNI34938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 20105283..20105337 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72455758..72455812 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020794 (Ube2g1) NM_025985 ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans) Gene [Source:MGI (curated);Acc:Ube2g1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 89319819..89319873 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 50844473..50844527 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28304498..28304552 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035829 (Gm347) NM_001005420 gene model 347, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685193]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 150617735..150617789 55
NO GENE  

 
Come back to gene ENSMUSG00000035829


For any suggestions or comments, please send an email to unitrap@crg.es