Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0413
Clone ID XR0413
Vector pGT0lxf
Project sanger

Sequence tag XR0413
Sequence
AATGTCTTGAGGCGGGCAATAAAGGCGCACCCCGGGCAACGGGGTGGACTTTTTTTTTTTTTTTTCTGGCTCCCTGTCCC
CGTCTGTCATTCTTATTCGTATCCAGTGTATCTATACGCGTTATTATTCCCGTTCCCGCTTTCGAATTCACCGACTTCAC
CCTTCCCAGCCAGACGCAGACGCCCCCCGGCGGCCCCGGCGGCGCGGGAGGCCCGGGCGGAGCGGGCGCAGGCGGCGCGG
CCGGCCAGCTCGACGCACAA
Sequence Type mRNA
Unitrap ID UNI2625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72876677..73612197 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058301 (Upf1) NP_001116301 UPF1 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107995]

 
Come back to gene ENSMUSG00000058301


For any suggestions or comments, please send an email to unitrap@crg.es