Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14816F4
Clone ID IST14816F4
Vector VICTR76
Project tigm

Sequence tag IST14816F4BBF1
Sequence
GACACACACAAGACGGGGAGAGCGAGCCACGCCGCCGCTCCTCCACAGTCTCCCGTTAATGATCCTTCCGCAGGTTCACC
TACGGAAACCTTGTTACGACTTTTACTTCCTCTAGATAGTCAAGTTCGACCGTCTTCTCAGCGCTCCGCCAGGGCCGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 39985044..39985202 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045999 (CT010467.6)  


Sequence tag IST14816F4HMF1
Sequence
GACACACACAAGACGGGGAGAGCGAGCCACGCCGCCGCTCCTCCACAGTCTCCCGTTAATGATCCTTCCGCAGGTTCACC
TACGGAAACCTTGTTACGACTTTTACTTCCTCTAGATAGTCAAGTTCGACCGTCTTCTCAGCGCTCCGCCAGGGCCGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 39985044..39985202 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045999 (CT010467.6)  


Sequence tag IST14816F4HMR1
Sequence
CAGGTTGTCCTCAAACTCGTANGCTCTGCCTGCCTCTACCTTTGGAGTGCTGGGATCAGAGGCGCGTGTCACCACATCTG
GTTTATGGTCAAACTAGAGGTCCACGTTGGCTAGCACTCGGTTC
Sequence Type genomic DNA
Unitrap ID UNI10230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140860812..140860935 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es