Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14432G12
Clone ID IST14432G12
Vector VICTR74
Project tigm

Sequence tag IST14432G12HMF2
Sequence
ACATGGTGGCTCACAACCACCTGTAATGAGATCTGACTCTCTCTTCTGGAGTGTCGGAAGACAGCTACAGTGTACTTACA
TATTAAAAAAAAAAAAAAAT
Sequence Type genomic DNA
Unitrap ID UNI30759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 38138909..38139007 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 125067576..125067674 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025551 (Fgf14) NM_010201 fibroblast growth factor 14 Gene [Source:MGI (curated);Acc:Fgf14-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705584..25705682 97
NO GENE  


Sequence tag IST14432G12BBF1
Sequence
ACATGGTGGCTCACAACCACCTGTAATGAGATCTGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126308731..126308768 38
NO GENE  


Sequence tag IST14432G12HMR1
Sequence
ATGTGGTTGCTGGGATTTGAACTCCAGACCTTCGGAAGAGCAGTCGG
Sequence Type genomic DNA
Unitrap ID UNI32046 UNI32047 UNI34939 UNI34940 UNI34941

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4684555..4684601 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6381011..6381057 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6528078..6528124 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5043142..5043188 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022536 (3930401K13Rik) NM_028720 RIKEN cDNA 3930401K13 gene Gene [Source:MGI Symbol;Acc:MGI:1921272]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 7578472..7578518 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14215991..14216037 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039219 (Arid4b) NM_194262 AT rich interactive domain 4B (RBP1-like) Gene [Source:MGI (curated);Acc:Arid4b-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8422185..8422231 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5851282..5851328 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3302269..3302315 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27435517..27435563 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 19727186..19727232 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4598516..4598562 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7420809..7420855 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16842943..16842989 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049130 (C5ar1) NM_007577 complement component 5a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:88232]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8060897..8060943 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003161 (Sri) NM_001080974 sorcin Gene [Source:MGI (curated);Acc:Sri-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11049017..11049063 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16219234..16219280 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 8854515..8854561 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015342 (Xk) NM_023500 Kell blood group precursor (McLeod phenotype) homolog Gene [Source:MGI (curated);Acc:Xk-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24740965..24741011 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16028371..16028417 47
NO GENE  

 
Come back to gene ENSMUSG00000015342


For any suggestions or comments, please send an email to unitrap@crg.es