Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14551H10
Clone ID IST14551H10
Vector VICTR74
Project tigm

Sequence tag IST14551H10HMR1
Sequence
CCCACTGTGCCCGTTTATGTGGTGCTGGGAATTGAACCCAGGGCTTTNATGCATGACAAGCAAGGGCACTCTACCAGCTG
ANCCTCACCCCTGCTCCAACCCAAGCTTCTGAGTCCATGTCCTTAACCAACGTCGCCAGTGTTTCTAACTGCCTTTANAG
AAAGAAAGGACCGGCTGAGGATATAGCTCAGTGCTACACAGAAAGTTTGTCTAGCATTTGTGAAGTACACGCCTCAAATC
TGCCAAAACAATTAATAATATTAACAACAATAATAAAACTTTTAAAAAAGCTTCANTCTGGGGCTGGANAGATGGCTCAG
TGGTTAANAGCACTTCCAAAGGTCCTGAGTTCAAATTCCTGCAACCNCATGGTGGCTCACAGCNNTCTGTAATGANATCT
GACGCCCTCTTCANGTGTGTCTGNNNCAGCTACAGTGTACTTACATGTAATAAATAAATAAATTAAAAAAAAANAN
Sequence Type genomic DNA
Unitrap ID UNI19344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134149133..134149606 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030681 (Mvp) NP_542369 major vault protein Gene [Source:MGI (curated);Acc:Mvp-001]


Sequence tag IST14551H10BBF1
Sequence
GGTCCCACCTGCCATCCCAGCACTCAGAAGGTCCAAGGGGANNGNCCCANNNNANCCTTAATTACACAGCAAGCTTGGAC
CAGACACGAGCCTCCATCTCAAGACAAAAGAAAAACAAGCAAAAACAGAAGGAAAGGTTCTTGCTGTTTGGGGTGTGTGT
ACAGAGGCTACATGACAGCCTTGGGCGTTTATCTTCAGGTAACATGCACTTTTTTCTTTTCTTTTCTTGGTTTTTCAAGA
CAGGGTTTCTTTGTGTAGCTCTGGCTGTCCTCAAATCGGAAACCAGCAGCCTGAGTGCTGGGCATGTGTTACCCCCACCC
AGCTTACTTTCTGTTTTTAATTTGTTAAATTTTATTAAGTGGGTGCGTGTGCCANANTGTGCCGTGGAAGTCTTCTTCCN
CCGTGTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134149605..134150015 389
 
EST/CDNA Est Name
  CK794384.1 - BQ960711.1 - CF893306.1 - BE373579.1 - CN673906.1 - CD550959.1 - CD553287.1 - CA565014.1 - BB853305.1 - BB857765.1 - BB860930.1 - CB232751.1 - BQ937645.1 - BB851648.1 - CF165839.1 - BY062221.1 - BY226254.1 - CA556964.1 - BY227441.1 - BE287281

 
Come back to gene CK794384.1 - BQ960711.1 - CF893306.1 - BE373579.1 - CN673906.1 - CD550959.1 - CD553287.1 - CA565014.1 - BB853305.1 - BB857765.1 - BB860930.1 - CB232751.1 - BQ937645.1 - BB851648.1 - CF165839.1 - BY062221.1 - BY226254.1 - CA556964.1 - BY227441.1 - BE287281


For any suggestions or comments, please send an email to unitrap@crg.es