Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14639G2
Clone ID IST14639G2
Vector VICTR74
Project tigm

Sequence tag IST14639G2HMR1
Sequence
CAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGG
Sequence Type genomic DNA
Unitrap ID UNI6913 UNI13860 UNI32787 UNI32793 UNI32794 UNI32795 UNI32796 UNI32797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 15424..15457 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6655630..6655663 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10642724..10642757 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28678562..28678595 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32120048..32120081 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 58747135..58747168 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050891 (Tatdn1) NM_175151 TatD DNase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916944]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37336388..37336421 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 58896123..58896156 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13738111..13738144 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30816922..30816955 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 15366415..15366448 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6177068..6177101 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 17387029..17387062 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060924 (Csmd1) NM_053171 CUB and Sushi multiple domains 1 Gene [Source:MGI Symbol;Acc:MGI:2137383]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11974035..11974068 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029629 (Phf14) NM_029404 PHD finger protein 14 Gene [Source:MGI (curated);Acc:Phf14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29769935..29769968 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037337 (Map4k1) NM_008279 mitogen-activated protein kinase kinase kinase kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1346882]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 69962140..69962173 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029208 (Guf1) NM_172711 GUF1 GTPase homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Guf1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21167843..21167876 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 63174566..63174599 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027820 (Mme) NM_008604 membrane metallo endopeptidase Gene [Source:MGI Symbol;Acc:MGI:97004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57651276..57651309 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062949 (Atp11c) NM_001037863 ATPase, class VI, type 11C Gene [Source:MGI Symbol;Acc:MGI:1859661]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 55388745..55388778 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026824 (Kcnj3) NM_008426 potassium inwardly-rectifying channel, subfamily J, member 3 Gene [Source:MGI (curated);Acc:Kcnj3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14113755..14113788 34
NO GENE  

 
Come back to gene ENSMUSG00000026824


For any suggestions or comments, please send an email to unitrap@crg.es