Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST11827-NR
Clone ID PST11827-NR
Vector U3NeoSV1
Project escells

Sequence tag PST11827-NR
Sequence
AGGACAGACCCAGGTGACAAAGTTAATGTAAATGTCAGAAGCCTTAGGAGCTTTACCCAGTGTTCATTTGATTGTGCAAA
GTGGACTAAATGCAGGGATTCTTGAGCTTGAATTTAAGCCCAAGGTAACTTTATGGGACCCTTGGATCACTCAGCTCTTA
CATGAACAATAATGGAAATAGTTTCCACCATAGACAGGTTCAAACCAGTTAAATGGGTTTACATATGTA
Sequence Type genomic DNA
Unitrap ID UNI15167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70253836..70254062 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031351 (Zfp185) NP_001102513 zinc finger protein 185 Gene [Source:MGI (curated);Acc:Zfp185-001]

 
Come back to gene ENSMUSG00000031351


For any suggestions or comments, please send an email to unitrap@crg.es