Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13840F1
Clone ID IST13840F1
Vector VICTR74
Project tigm

Sequence tag IST13840F1HMF2
Sequence
GTTCTGAAAAGGGGACTTTGAGAATTTCCAAGGCCACCATAGATGAATTTAGGCCTTGTCTAGTCCCTGATTTTACTGGG
ATTGCTTCCAGCTTCTCACCATTTACTTTGATGTTGGCTACTGGTTTGCTGTAGATTGCTTTTATCATGTTTAGGTATGG
GCCTTGAATTCCTAATCATTCCAAGACTTTTATCATGAATGGGTGTC
Sequence Type genomic DNA
Unitrap ID UNI9937

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 84490..1115132 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053211 (Zfy1) NM_009570 zinc finger protein 1, Y linked Gene [Source:MGI Symbol;Acc:MGI:99212]


Sequence tag IST13840F1BBF1
Sequence
GTTCTGAAAAGGGGACTTTGAGAATTTCCAAGGCCACCATANATGAATTTAGGCTCCATATATTCTCCTTTTTAGTTTTT
TTGTTTTTTTGTTTATTTGGTTTTTCNAGACAGGGTTTCTCTGTATANCCCTGCCTGTCCTGGAACTCACTCTGCCCGGC
ANCTACAGACAGTTCTAAGCCATTGTGTGGGTGCTGGAAAGTGAACTCTGGTCTTTTTCTGGANCNCCANGTGCTTGTNN
CTCCGGNNCCCTTTCTCTANCCTGTGTAANTGTCATTTTANNGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053211


For any suggestions or comments, please send an email to unitrap@crg.es