Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14738F3
Clone ID IST14738F3
Vector VICTR76
Project tigm

Sequence tag IST14738F3HMF2
Sequence
AACGCAACGTGTACCGGGGATTTCTCTCGCCACTGGAACAAGAAGCTGGTCAGGATCTGAGACGCTTGTGTTCTGATTTT
TAAAAAGGAAAGGAAAAAAGAAAAAGAAAGAAAAGAAATGGCAGTTGGGAATGTTAGTGCATATCTGTAATCCCAAACGC
TCAGAAGGCTGAGGTGAGAAGCCAGAGGTCAAGGCAAACATGGGGAAAAATAAAAAGACAAACAGGAGAGAAAGGGAAAG
AAGAAAAACCATTGGAAATGACCCTGCANACCAAGTTTTCAGTATTTGAAAATGTATGTTTCCTGGGGGTGTATGTGTAT
ATACCGATGTTCATGTCNTATGTATATACAACTCTGTGTGTGCTGTGTACNTGTAAACACNNNTACTGTTTGGGGANCGG
ANNATCTCTGGANTNNGTATCNNGCNNGNCTNNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59556283..59556702 393
NO GENE  


Sequence tag IST14738F3BBF1
Sequence
NNNCNCCTNANANNGNNNCCNNNGNNNCNNNNCCNNNACNNNTNGTGNNNNTTNNTCNGNCNNANNNCNNNNGATTNNNC
GGGGTCNATCNACGGTATCNATTANTCCAATTTATGGCAGTTGGGAATGTTANTGCATATCTGTAATCCCAAACGCTCAN
AAGGCTGAGGTGAGAAGCCAGAGGTCAAGGCAAACATGGGGAAAAATAAAAAGACAAACAGGAGAGAAAGGGAAAGAAGA
AAAACCATTGGAAATGACCCTGCAGACCAAGTTTTCAGTATTTGAAAATGTATGTTTCCTGGGGGTGTATGTGTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59556385..59556585 197
NO GENE  


Sequence tag IST14738F3HMR1
Sequence
GCGTTCATTACGTTGCCCTCTCCGGGAGAGCCTTAAAGCCCATGACTTGAGCTGCAGCAGTGGAGACAGCTACCCTANCA
GCAATTGTCCTCCTCCCTGAACAGAGGAGGTGGGGCCGCTGCCCTGATCAGATGTAGCAATGAAAGCCTCAGCATCTAAA
AAGTGGGAGGTCCGTGAGGTCAGAAAACATCTATGCGATGCTGAACATAGATTAAGGAATTTGCATGCATCCCACANACC
TTTCCAGGCTGCAGTTGGTGGCNNCTGACCCACATTTTTANTCNTCCTCTGGGCTAGGCTGGGANGCTANACCCNCCN
Sequence Type genomic DNA
Unitrap ID UNI29755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59556698..59557014 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es