Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10655D1
Clone ID IST10655D1
Vector VICTR76
Project tigm

Sequence tag IST10655D1HMF2
Sequence
GTTGTTGTTGTTGTTTTGTTTTGTTTTGTTTTGTTTTTTTTGCCTCTGCCTCCCAAGTGTTGGGAGCAAAGGCATGC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165790: 57501..557866 40
NO GENE  


Sequence tag IST10655D1BBF1
Sequence
GTTGTTGTTGTTGTTTTGTTTTGTTTTGTTTTGTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI34944

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 120388898..120388937 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68828534..68828573 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 35995458..35995497 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103055295..103055334 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 75159205..75159244 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47206273..47206312 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21669889..21669928 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042453 (Reln) NM_011261 reelin Gene [Source:MGI Symbol;Acc:MGI:103022]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 66718969..66719008 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 41465912..41465951 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161928: 147780..147819 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165790: 557827..557866 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166351: 301500..301539 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166366: 7336..7375 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166418: 388910..388949 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166422: 324168..324207 40
NO GENE  

 
Come back to gene ENSMUSG00000042453


For any suggestions or comments, please send an email to unitrap@crg.es