Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12242H12
Clone ID IST12242H12
Vector VICTR76
Project tigm

Sequence tag IST12242H12BBF1
Sequence
CATTCTTTCTATAGGGCACATGGTTTTAAAATCTGATTCACTACATCTGAACTTTCCTTGTAGTACCACCAAAATAACAA
AAGACAGTTTATCTAGAATTTTTTAAGATTAATGACAATTTGACTGTGTTTGATACCTGGAGGTGCATACTATTTCACAG
AGGGAAAATCACTTTATTTCTTGCAAATGAGCATGTACAAAAGCAGTAAACAGAACTTATCATTTTAAAAATCAAAACTG
AATGATATTCTTTTACTCATACAGCTCATGAAAATGAAGCAGGCAAGCAGAAAGACAAGAAGCACAAGCCTGCTGGAAAA
AGAGGCTCCATTTTTCCGATGCAGTCCCTTCCCGCCCCAAGCAGAGCAGTAAAAGCAGAGAAACAGAGATTCGTTGCATC
AAATGGGAATCAGGGGGGTGGGAGAGCAGGAAAGATGGCTTACTGAAAACTGCAAATGAAATGGAAAACCCGAACAGATC
TG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 155120335..155120815 481
 
EST/CDNA Est Name
  AI323447.1 - AW490406.1 - BF714362.1 - AW457391.1


Sequence tag IST12242H12HMF2
Sequence
CAACATCTTCCAAATCCCAATAGCCACTGTGTCTGACCTGGTTTGGTTTTTTTGTTTGTTTGTTTGTTTGTTTTTTGAGA
TAAGGCCTTATAACCCTGGCCTTCCTGAAATTGATTATGTATCCCAGGTGAGTTTTAAACTTAGGACAGTTATCCTGCCT
CAGCCTCCCTGGGGTTACAGATGTGAGTCACCATGGTTAGCTCAGGTCACATCACTTTGATAAGCCATGTTTTGTCTTTC
TACTGTTAGTTGTAAATTAATAAATAGAAACACATACTGTCGGATTTACTTGTGGTGTCATGGATTATACAAAAAGCCTT
AAGACAAAGTTAGAGCCATGCAGAGAAGACAATAAGAAATGGAACATGTCCACTTCTGCAAATGCAGCATTAACGGGTAA
CTGTATTTTACCTGATGGA
Sequence Type genomic DNA
Unitrap ID UNI13373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35967162..35967579 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es