Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14823A2
Clone ID IST14823A2
Vector VICTR76
Project tigm

Sequence tag IST14823A2BBF1
Sequence
ATAGCTGTTTCCTTCTGGGGCTGGACTGCTGTTCTTTTGGAAGGTGCTGGAGTATTCTGAGAAGACTCAAAACACTGTTG
CTCACGTCCAGATGTGCCTTCAGTGAACTGGTGTGTTCGGGCATGGCCTGGCCTGAGAGTGCCTTGAGGGTAGAGGTGCT
GTCCGACTTATCTGTGTGACAGTGCAGCAGTTGCTTGGCGTCTGGAGGGCCTGACACAGAGAGCATGTTTATTAATTGAC
TCANATCATTCAAGTGTGAGCATATGGTTAAACTNANGTGCCTATTCTGTAATTTGTGTCNANGCATGTGGGTGGTTAAT
GTTN
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126143539..126143861 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]


Sequence tag IST14823A2HMR1
Sequence
TATGGGGTCCCTCCATCANAGTTCCCAGCCTGAATTTTAATTCCGTCTTTTGATGACGCCACTAGCATTTTCCCAATGAT
CCANCTGACTCCAGTTCTCCAGCCCTTCACCTGGCAGCTTCCTTCTGTCCTGTAACAAACAAGCCCCCTTTCTTCATCAC
CCCANAACCCATCANACACTCGTCAGGATAAAACCATTANCAATTCANGACATAANCTTTCGTCAGTCTGTCTGGACGTG
GGTCCTACTCTATANTCCCCGGGTTTGTTGGTNNTANTTTCCAACCTANAAAATANNGATTTACNCTCTACCTNNCNNNG
CNATCTGTGTTTGGGAAAATNNNNNNANTACACATTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es