Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13317F1
Clone ID IST13317F1
Vector VICTR74
Project tigm

Sequence tag IST13317F1BBF1
Sequence
TTCTCTGCTGCAAGTCTCANTCCAAGCTATTGATGAGCTCATTTTNNTTCACCCCTTACAGTATTTTTTTGTTGTTTTTC
CCCCCAGTCAAANTTTTTGCTATGTATTCCATGATAACCTAAATTCTGTTCCTANCCNNCCNGACCTTGAACTTTCCATC
NCCNTCCCNTTGTCNTGGCCGGTTGCANNANGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13317F1HMF1
Sequence
GGAGTTCCTGTGGTCTGGAGGGAAACCCTCAACCCAGCC
Sequence Type genomic DNA
Unitrap ID UNI34946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20525886..20525923 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003233 (Dvl3) NM_007889 dishevelled 3, dsh homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108100]

 
Come back to gene ENSMUSG00000003233


For any suggestions or comments, please send an email to unitrap@crg.es