Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0392
Clone ID XR0392
Vector pGT0lxf
Project sanger

Sequence tag XR0392
Sequence
TTCCGGGTTCGGAGCCATTCCGGATGCTTTAGGCTGCCGGATGTCTGATCTCCGGATAACTGAGGCGTTTCTGTACATGG
ATTATCTGTGTTTTCGAGCGCTTTGCTGCAAGGGACCACCACCTGCGCGCCCTGAATATGACTTGGTTTGCATAGGTCTC
ACGGGCTCCGGGAAAACCAGCCTGCTGTCCGAGCTCTGCAGCGAAAGCCCGGAGAACGTTGTGTCGACCACAGGTTTTAG
TATAAAGGCAGTGCCATTCCAGAATGCCGTTTTGAATGTAAAAGAACTTGGAGGAGCTGACAATATCCGGAAATACTGGA
GCCGCTACTACCAAGGATCTCAAGGGGTCATATTCGTATTAGACAGTGCCTCTTCAGAGGATGACTTAGAAACTGCTAGG
AACGAACTGCACTCCGCTCTCCAGCACCCACAGCTATGCACTTTACCCTTTTTGATATTGGCCAATCATCAAGACAAGCC
AGCAGCTCGCTCAGTACAAGAG
Sequence Type mRNA
Unitrap ID UNI510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114584817..114757998 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es