Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14494B3
Clone ID IST14494B3
Vector VICTR74
Project tigm

Sequence tag IST14494B3HMR1
Sequence
CTCTATGCCTCTTCAGTGTAGGAATGAATTACAGGCGTAGGTTGCCGTGACTGACTTTATAAACTCATTTTGACAGGGGA
GAGAGATTTTGTTCTGTCTCCTCCTTCCCTTAGTAATCTACTTAGCTCTGTTGAGGGAGAGGAACCATGTGCTGAGCCCA
CATTTTTGGCTTATCTTAAAGAGATCTTCCTTTTGAAACCTATCTGAACTTTTTATAATGATGGGTGGGTAAAGCATCTC
CCACACTCANAATCCCTGTCTGGGGTAAAGACATTGGCGTTAGACTGCGGGTTTGGTTCNNTCNNACTCTGTCCACACCC
ANATTTCNNAGCTCTTGGGATCCCCCANAN
Sequence Type genomic DNA
Unitrap ID UNI20228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127532415..127532761 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es