Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST11710-NR
Clone ID PST11710-NR
Vector U3NeoSV1
Project escells

Sequence tag PST11710-NR
Sequence
GTTTCCGTTTCCACCTTCGTTAATCGGGGCCCTGGCGACCACTGCTCCTGTCCACCGGAGCAGGTCCCTTGCTGGGATTG
AAAGATAACGGTATCTGCACATAAAAGGGATTTAGTCCTGGGACCAGGCCTCCTCCCAGACCATAACCTTAACATATACC
ACGTCTCTGTACCTTATTGATCGTTCATCGGTAATCTTACGGTAGTCCGTGAGGTTGCGCATCTCCCGTCCCTGCGTCCT
GGCCTCCTGTCCCAAGTTTCACGTGTGAGCCCCTCCAGTCATCGGCACA
Sequence Type genomic DNA
Unitrap ID UNI10818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80261758..80262044 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020211 (Sf3a2) NP_038679 splicing factor 3a, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:104912]

 
Come back to gene ENSMUSG00000020211


For any suggestions or comments, please send an email to unitrap@crg.es