Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST11691-NR
Clone ID PST11691-NR
Vector U3NeoSV1
Project escells

Sequence tag PST11691-NR
Sequence
GGGCTGCTCTGCCTCTGCACCTAAATTGGGACTTAGAAGTAAAGCTACGCGTGAGCTCACTCGCATCTGGCCTAGAACAG
TTTCTCAGGCACTCAGCAGCCTTCAGAAAGAAGTATCTTCATTTTTACCTAGTTTTATTGTTCCAATTTCCTGTGTGTTT
CTTAATAAACAAGCAGAATTTTTGTCCTGCTTTATCCAGGTATTAAAAGACGAGAAGTTGGATCCACTGAGTTAGTATGT
TTCCTTGAAAAAGAAAAGTGATTAAACTTAAGTTTAAGCCTTCTT
Sequence Type genomic DNA
Unitrap ID UNI15177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61741491..61741774 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

 
Come back to gene ENSMUSG00000024576


For any suggestions or comments, please send an email to unitrap@crg.es