Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10012H1
Clone ID IST10012H1
Vector VICTR75
Project tigm

Sequence tag IST10012H1HMF1
Sequence
TGTGTATATACACACATGTACAGGTGACTGCAAAGACAAAAAAAAGGAAGGAAGGGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGGCGG
Sequence Type genomic DNA
Unitrap ID UNI13027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72731565..72731651 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es